WormBase Tree Display for RNAi: WBRNAi00085739
expand all nodes | collapse all nodes | view schema
| WBRNAi00085739 | Homol | Homol_homol | C29E4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ttttggaatcaccgtcatcattctctttggaagtcttgaagcttaacaacaatggattaggaataggaggaaaacaaatcgcaaaatcattgactgagtgtctcagaaagtcaattgctgtgggaggcgagaatcgattgagattgaaaacatttattgctggaagaaatcgtttggaaaatccaggagcacatgcactggcggctacttttaaggtatttatagttaaacactttaatttctaaaacttatttttaggctcttgaaacggttgaatggtttgatgttcgtcaaaatggaattcatgaagaaggaattcgtgctctggtggctgcattgaaacacaacagaaatcttcgatatctctggcttgaagacaatacagtactccccaagggtgcaaaggctcttgcaaaaactctggaatcttggccgaagttagaagttttgaatttgtcagactgtttgattcgtgacgctggatgcaattacattattgatcacttgaatcctcaacatcatcgccatcttaaaaatgtttacctttgcggaaacgagctcacaccacccgtcgctaagctcctgattcaaaaatggtcaaagtttgatggtcttacaccgaaaccagtgcttcatattcataccaattcgtttggtgatgaattctctgatgttgctggaatggcaccggaaaatgtgaatgttggagatgaagatgatgatttgggaagtttggatggagatcaagaggagtacaatagtaaatcgtcagattcggaagatgcagatttggatgatgacgatgaagatgatgatgaggaagcggagattcagattatcgacaatggagaatcacagttaaaacttgcaatggatcgaattgatcgtctggatatcgactttgaaagcagattccaggaagacactgcacgtgt | |||
| Experiment | Laboratory | OD | |||
| Date | 24 Mar 2011 00:00:00 | ||||
| Strain | WBStrain00029219 | ||||
| Treatment | Larval L4 stage worms were soaked in dsRNA for 24 hrs at 20C. After soaking, the worms were transferred to NGM plates seeded with OP50 E. coli and allowed to recover for 48 hrs prior to imaging. | ||||
| Temperature | 20 | ||||
| Delivered_by | Soaking | ||||
| Inhibits | Predicted_gene (2) | ||||
| Gene | WBGene00004303 | Inferred_automatically | RNAi_primary | ||
| Transcript | C29E4.3a.1 | Inferred_automatically | RNAi_primary | ||
| C29E4.3b.1 | Inferred_automatically | RNAi_primary | |||
| C29E4.3b.2 | Inferred_automatically | RNAi_primary | |||
| DB_info | Database | Phenobank2 | Gene&RNAID | GeneID=504278 | |
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00038381 | ||||
| Phenotype | WBPhenotype:0000291 | ||||
| WBPhenotype:0000313 | Remark | Randomized nuclear stages observed in meiotic progression during oogenesis . | |||
| WBPhenotype:0000688 | |||||
| WBPhenotype:0001028 | Remark | Fragmented nuclei. | |||
| Irregular nuclear shape. | |||||
| WBPhenotype:0001355 | Remark | Distal region of the gonad contains a constriction. | |||
| WBPhenotype:0001361 | Remark | Oocyte chromatin abnormally condensed. | |||
| Pachytene chromatin abnormally condensed. | |||||
| WBPhenotype:0001792 | Remark | Nuclear size moderately small in the proximal germ line (51 - 70 percent of normal). | |||
| Nuclear size small in the proximal germ line (21 - 50 percent of normal). | |||||
| WBPhenotype:0001940 | Remark | Vesiculated rachis. | |||
| WBPhenotype:0001941 | |||||
| WBPhenotype:0001942 | |||||
| WBPhenotype:0001944 | |||||
| WBPhenotype:0001952 | Remark | Nuclear spacing disrupted prior to expansion in the germline. | |||
| Nuclei unevenly distributedin the germlne. | |||||
| WBPhenotype:0001956 | Remark | anucleate compartments/oocytes | |||
| WBPhenotype:0001957 | Remark | Gonad appears similar to that normally seen at earlier developmental stages. Compartments fail to expand and rachis is absent or narrow. | |||
| WBPhenotype:0001969 | Remark | Budded compartments present in surrounding sheath, distal to turn in gonad. | |||
| WBPhenotype:0001971 | Remark | anucleate compartments/oocytes | |||
| WBPhenotype:0001972 | |||||
| WBPhenotype:0001973 | Remark | Compartments distal to turn in gonad vary in size. | |||
| WBPhenotype:0001979 | Remark | Vesiculated rachis. | |||
| WBPhenotype:0001980 | Remark | Delayed compartment expansion at turn in gonad. | |||
| WBPhenotype:0001981 | Remark | No compartment expansion at turn in gonad. | |||
| Remark | Experiment SS428 | ||||
| Method | RNAi |
