WormBase Tree Display for RNAi: WBRNAi00085739
expand all nodes | collapse all nodes | view schema
| WBRNAi00085739 | Homol | Homol_homol | C29E4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ttttggaatcaccgtcatcattctctttggaagtcttgaagcttaacaacaatggattaggaataggaggaaaacaaatcgcaaaatcattgactgagtgtctcagaaagtcaattgctgtgggaggcgagaatcgattgagattgaaaacatttattgctggaagaaatcgtttggaaaatccaggagcacatgcactggcggctacttttaaggtatttatagttaaacactttaatttctaaaacttatttttaggctcttgaaacggttgaatggtttgatgttcgtcaaaatggaattcatgaagaaggaattcgtgctctggtggctgcattgaaacacaacagaaatcttcgatatctctggcttgaagacaatacagtactccccaagggtgcaaaggctcttgcaaaaactctggaatcttggccgaagttagaagttttgaatttgtcagactgtttgattcgtgacgctggatgcaattacattattgatcacttgaatcctcaacatcatcgccatcttaaaaatgtttacctttgcggaaacgagctcacaccacccgtcgctaagctcctgattcaaaaatggtcaaagtttgatggtcttacaccgaaaccagtgcttcatattcataccaattcgtttggtgatgaattctctgatgttgctggaatggcaccggaaaatgtgaatgttggagatgaagatgatgatttgggaagtttggatggagatcaagaggagtacaatagtaaatcgtcagattcggaagatgcagatttggatgatgacgatgaagatgatgatgaggaagcggagattcagattatcgacaatggagaatcacagttaaaacttgcaatggatcgaattgatcgtctggatatcgactttgaaagcagattccaggaagacactgcacgtgt | |||
| Experiment (6) | |||||
| Inhibits | Predicted_gene | C29E4.3b | Inferred_automatically | RNAi_primary | |
| C29E4.3a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004303 | Inferred_automatically | RNAi_primary | ||
| Transcript | C29E4.3a.1 | Inferred_automatically | RNAi_primary | ||
| C29E4.3b.1 | Inferred_automatically | RNAi_primary | |||
| C29E4.3b.2 | Inferred_automatically | RNAi_primary | |||
| DB_info | Database | Phenobank2 | Gene&RNAID | GeneID=504278 | |
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00038381 | ||||
| Phenotype | WBPhenotype:0000291 | ||||
| WBPhenotype:0000313 | Remark | Randomized nuclear stages observed in meiotic progression during oogenesis . | |||
| WBPhenotype:0000688 | |||||
| WBPhenotype:0001028 | Remark | Fragmented nuclei. | |||
| Irregular nuclear shape. | |||||
| WBPhenotype:0001355 | Remark | Distal region of the gonad contains a constriction. | |||
| WBPhenotype:0001361 | Remark | Oocyte chromatin abnormally condensed. | |||
| Pachytene chromatin abnormally condensed. | |||||
| WBPhenotype:0001792 | Remark | Nuclear size moderately small in the proximal germ line (51 - 70 percent of normal). | |||
| Nuclear size small in the proximal germ line (21 - 50 percent of normal). | |||||
| WBPhenotype:0001940 | Remark | Vesiculated rachis. | |||
| WBPhenotype:0001941 | |||||
| WBPhenotype:0001942 | |||||
| WBPhenotype:0001944 | |||||
| WBPhenotype:0001952 | Remark | Nuclear spacing disrupted prior to expansion in the germline. | |||
| Nuclei unevenly distributedin the germlne. | |||||
| WBPhenotype:0001956 | Remark | anucleate compartments/oocytes | |||
| WBPhenotype:0001957 | Remark | Gonad appears similar to that normally seen at earlier developmental stages. Compartments fail to expand and rachis is absent or narrow. | |||
| WBPhenotype:0001969 | Remark | Budded compartments present in surrounding sheath, distal to turn in gonad. | |||
| WBPhenotype:0001971 | Remark | anucleate compartments/oocytes | |||
| WBPhenotype:0001972 | |||||
| WBPhenotype:0001973 | Remark | Compartments distal to turn in gonad vary in size. | |||
| WBPhenotype:0001979 | Remark | Vesiculated rachis. | |||
| WBPhenotype:0001980 | Remark | Delayed compartment expansion at turn in gonad. | |||
| WBPhenotype:0001981 | Remark | No compartment expansion at turn in gonad. | |||
| Remark | Experiment SS428 | ||||
| Method | RNAi |
