WormBase Tree Display for Feature: WBsf979158
expand all nodes | collapse all nodes | view schema
| WBsf979158 | SMap | S_parent | Sequence | F39D8 |
|---|---|---|---|---|
| Name | Public_name | CEH-20 binding site | ||
| Sequence_details | Flanking_sequences | aaaactaccgaatttcgtaatgagacgttt | aatttctcaaaaaagggtatttgtgtatta | |
| Mapping_target | F39D8 | |||
| DNA_text | tgaa | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | CEH-20 binding site, within the 4th intron of psa-3, (i4c-S1 probe) | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00027741 | ||
| Associations | Associated_with_gene | WBGene00009560 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000486 | |||
| Bound_by_product_of | WBGene00000443 | |||
| Method | TF_binding_site |
