WormBase Tree Display for Feature: WBsf979087
expand all nodes | collapse all nodes | view schema
| WBsf979087 | SMap | S_parent | Sequence | C03F11 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tccatcagcattcaaccctagaactttgct | acgtcattaatttgattattgacaatgtta | |
| Mapping_target | C03F11 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | First intron of scav-1. | ||
| SO_term | SO:0001492 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00015389 | ||
| Associated_with_Interaction | WBInteraction000534317 | |||
| WBInteraction000534318 | ||||
| WBInteraction000534319 | ||||
| WBInteraction000534320 | ||||
| WBInteraction000534321 | ||||
| WBInteraction000534322 | ||||
| Remark | [150922 gw3] This is the first intron of scav-1 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00044244 | |
| Method | regulatory_region |
