WormBase Tree Display for Feature: WBsf979053
expand all nodes | collapse all nodes | view schema
| WBsf979053 | SMap | S_parent | Sequence | C08A9 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | cttcaaagcttgttcaaccggttgcggggt | agttctcgccgtccgctccaagcacactct | |
| Mapping_target | C08A9 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | First intron of sod-3. | ||
| SO_term | SO:0001492 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00004932 | ||
| Associated_with_Interaction | WBInteraction000533953 | |||
| WBInteraction000533954 | ||||
| WBInteraction000533955 | ||||
| WBInteraction000533956 | ||||
| WBInteraction000533957 | ||||
| WBInteraction000533958 | ||||
| WBInteraction000533959 | ||||
| WBInteraction000533960 | ||||
| WBInteraction000533961 | ||||
| WBInteraction000533962 | ||||
| WBInteraction000533963 | ||||
| WBInteraction000533964 | ||||
| WBInteraction000533965 | ||||
| WBInteraction000533966 | ||||
| WBInteraction000533967 | ||||
| WBInteraction000533968 | ||||
| Remark | [150922 gw3] This is the first intron of sod-3 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00044244 | |
| Method | regulatory_region |
