WormBase Tree Display for Feature: WBsf978990
expand all nodes | collapse all nodes | view schema
WBsf978990 | SMap | S_parent | Sequence | T22G5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | taaaacttgcaaagaagccaaactctgttg | atggtttccatgaaagagtttattggacga | |
Mapping_target | T22G5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Promoter region of lbp-8. | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00002260 | ||
Associated_with_Interaction (19) | ||||
Remark | [150922 gw3] This is a region upstream of lbp-8 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |