WormBase Tree Display for Feature: WBsf978922
expand all nodes | collapse all nodes | view schema
WBsf978922 | SMap | S_parent | Sequence | Y102A5C |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tcgattggcaagtcggagagtgatgacatt | agactcgtacaacgacatggaagaccccgg | |
Mapping_target | Y102A5C | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00001161 | ||
Associated_with_Interaction | WBInteraction000531566 | |||
Remark | [150922 gw3] This is a region upstream of Y102A5C.18 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |