WormBase Tree Display for Feature: WBsf978797
expand all nodes | collapse all nodes | view schema
WBsf978797 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tcgcgcgtaaatgcgcccccctttaaagtc | acgtcattcctgtgctccgatactgaaatt | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Promoter region of Y54G2A.1. | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00003008 | ||
Associated_with_Interaction | WBInteraction000532250 | |||
WBInteraction000532251 | ||||
WBInteraction000532252 | ||||
WBInteraction000532253 | ||||
WBInteraction000532254 | ||||
WBInteraction000532255 | ||||
WBInteraction000532256 | ||||
WBInteraction000532257 | ||||
WBInteraction000532258 | ||||
WBInteraction000532259 | ||||
WBInteraction000532260 | ||||
WBInteraction000532261 | ||||
WBInteraction000532262 | ||||
Remark | [150922 gw3] This is a region upstream of Y54G2A.1 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |