WormBase Tree Display for Feature: WBsf978355
expand all nodes | collapse all nodes | view schema
WBsf978355 | SMap | S_parent | Sequence | D2021 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tcaggatcgtaattcatccgcagtaatgta | gaagacgctgctcgtcgccagggagtcagt | |
Mapping_target | D2021 | |||
Origin | Species | Caenorhabditis elegans | ||
History | Acquires_merge | WBsf978399 | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00000561 | ||
Associated_with_Interaction | WBInteraction000528911 | |||
WBInteraction000528912 | ||||
WBInteraction000528913 | ||||
WBInteraction000528914 | ||||
WBInteraction000528915 | ||||
WBInteraction000528916 | ||||
Remark | [150922 gw3] This is a region upstream of D2021.2 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |