WormBase Tree Display for Feature: WBsf919569
expand all nodes | collapse all nodes | view schema
WBsf919569 | SMap | S_parent | Sequence | F44E5 |
---|---|---|---|---|
Name | Public_name | HSE | ||
Sequence_details | Flanking_sequences | attgtctctcctccttctttctgctgcccagcca | cgttctagaaccttccattataagagaaagagacg | |
Mapping_target | F44E5 | |||
DNA_text | TTCGAGAA | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is a conserved binding site region 'HSE' for the Hsp70 genes F44E5.5 and F44E5.4. | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00005280 | ||
Associations | Associated_with_gene | WBGene00009692 | ||
WBGene00009691 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000178 | |||
Bound_by_product_of | WBGene00002004 | |||
Remark | This is a conserved binding site region 'HSE' for the Hsp70 genes F44E5.5 and F44E5.4. [2013-07-23 gw3] | |||
Method | TF_binding_site |