WormBase Tree Display for Feature: WBsf716963
expand all nodes | collapse all nodes | view schema
| WBsf716963 | SMap | S_parent | Sequence | F47G4 |
|---|---|---|---|---|
| Name | Public_name | ENH0006379 | ||
| Sequence_details | Flanking_sequences | aaagaaatcttactctatatgagcctaata | aaacataggccttccagcacgctgtgtttg | |
| Mapping_target | F47G4 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is a predicted enhancer region. These are intergenic TF-binding sites >500 bp from a gene start which overlap a TSS cluster, excluding regions that appear to be unannotated promoters based on having a signature of high H3K4me3/low H3K4me1. Nearest downstream gene=F47G4.7. Surounding gene organisation=tandem | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Associations | Associated_with_gene | WBGene00004875 | ||
| Remark | [130712 gw3] This is a predicted enhancer region from Julie Ahringer's paper. | |||
| Method | enhancer |
