WormBase Tree Display for Feature: WBsf660531
expand all nodes | collapse all nodes | view schema
| WBsf660531 | SMap | S_parent | Sequence | W08D2 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000020568 | ||
| Sequence_details | Flanking_sequences | actctctcacattttgactcgtttatcggt | gaggggtaaagtgcaactgcaaacaatagt | |
| Mapping_target | W08D2 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible (2) | ||||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 35 | |||
| Associations | Associated_with_gene | WBGene00001395 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
