WormBase Tree Display for Feature: WBsf648537
expand all nodes | collapse all nodes | view schema
WBsf648537 | SMap | S_parent | Sequence | ZK455 |
---|---|---|---|---|
Name | Public_name | MCP_0000034360 | ||
Sequence_details | Flanking_sequences | attcggcacgcctccattagttttcctcgc | tcgttcttttctatcgaaatcctttttttt | |
Mapping_target | ZK455 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 28 | |||
Associations | Associated_with_gene | WBGene00000040 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |