WormBase Tree Display for Feature: WBsf520104
expand all nodes | collapse all nodes | view schema
WBsf520104 | SMap | S_parent | Sequence | C05C8 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | CAAGCCCTGGGACAACACAATATTCCCGGA | TTTCAAAACGCTTTTTTTTGTTAATTTTTG | |
Mapping_target | C05C8 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | AMA-1 Binding Peaks in L3 larva from strain OP74 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00037946 | ||
WBPaper00035968 | ||||
Defined_by_analysis | modENCODE_2597_Snyder_TF_AMA-1 | |||
Score | 0.000386 | |||
Associations | Associated_with_transcription_factor | WBTranscriptionFactor000001 | ||
Bound_by_product_of | WBGene00001953 | |||
Remark | [120612 gw3] This is a modENCODE project from the Snyder Lab to find TF binding site regions by using ChIP-SEQ immunoprecipitation using an antibody to the TF or to PolII and then sequencing on a Solexa GA2 machine. | |||
Method | TF_binding_site_region |