WormBase Tree Display for Feature: WBsf267881
expand all nodes | collapse all nodes | view schema
| WBsf267881 | SMap | S_parent | Sequence | Y54G11A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | GATTTCGTCTAAAATACCCAAAAAAGTCGA | AAAATCACGAATTTTGGCAAAAAATCGCTC | |
| Mapping_target | Y54G11A | |||
| DNA_text | gatttcgtctaaaatacccaaaaaagtcgaAaaaatcacgaattttggcaaaaaatcgctc | |||
| Origin | Species | Caenorhabditis elegans | ||
| History | Acquires_merge | WBsf898512 | ||
| Visible | Description | Possible genome sequence error found in analysis of N2 and the sister strain LSJ2 RNASeq data | ||
| has NO EST evidence; | ||||
| Insertion gatttcgtctaaaatacccaaaaaagtcgaAaaaatcacgaattttggcaaaaaatcgctc | ||||
| Possible genome sequence error found in RNASeq analysis of ten lab isolates of N2 by Kate Weber. | ||||
| Defined_by | Defined_by_paper | WBPaper00037807 | ||
| WBPaper00040097 | ||||
| Method | Genome_sequence_error |
