General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
| WBsf129849 | SMap | S_parent | Sequence | C05C8 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CTATTTACAACAATTAAGTAACCATTTCAG | TGACTAAACCGAACCAGCACAAAAATGCTG | |
| Mapping_target | C05C8 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence (19) | |||
| Defined_by_paper | WBPaper00037948 | |||
| Defined_by_analysis (69) | ||||
| Remark (69) | ||||
| Method | SL1 |
