WormBase Tree Display for Feature: WBsf047663
expand all nodes | collapse all nodes | view schema
| WBsf047663 | SMap | S_parent | Sequence | T15H9 |
|---|---|---|---|---|
| Name | Public_name | pha-4 binding site | ||
| Sequence_details | Flanking_sequences | ggatcgcctttttcgggttggctccccgat | acagcttatatttactgtaggccccgccca | |
| Mapping_target | T15H9 | |||
| DNA_text | tgtttgc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | pha-4 binding site, within the promoter region of hlh-6 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00028728 | ||
| Associations | Associated_with_gene | WBGene00001952 | ||
| Associated_with_Interaction | WBInteraction000520207 | |||
| WBInteraction000524087 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000020 | |||
| Bound_by_product_of | WBGene00004013 | |||
| Method | TF_binding_site |
