WormBase Tree Display for Feature: WBsf047656
expand all nodes | collapse all nodes | view schema
| WBsf047656 | SMap | S_parent | Sequence | R13A5 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tgtggttcacctgtcagatcattcacttgtc | ttatagtccctcaatttgaattcgcaacatt | |
| Mapping_target | R13A5 | |||
| DNA_text | CTTCCTGACCAACTTCCGTCAGC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Transcription factor binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00027690 | ||
| Associations | Associated_with_gene | |||
| Associated_with_transcription_factor | WBTranscriptionFactor000135 | |||
| Bound_by_product_of | WBGene00002990 | |||
| Remark | S17 mediates repression of lin-39 in VPCs where the Ras pathway is inactive, in vitro. LIN-1 also functions positively on lin-39 expression in P6.p. | |||
| Method | TF_binding_site |
