WormBase Tree Display for Feature: WBsf047567
expand all nodes | collapse all nodes | view schema
| WBsf047567 | SMap | S_parent | Sequence | W03F8 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | atcatgattcacagttcccattttaagctt | tgatagaatttaaataatttactgtttcttc | |
| Mapping_target | W03F8 | |||
| DNA_text | GTTGTTGTCC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible transcription factor (PHA-4) binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00025009 | ||
| Associations | Associated_with_gene | WBGene00006586 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000020 | |||
| Bound_by_product_of | WBGene00004013 | |||
| Remark | A 5' upstream region of tni-4 has a partial homology to the PHA-4 binding site of myo-2. | |||
| Method | TF_binding_site |
