WormBase Tree Display for Feature: WBsf047499
expand all nodes | collapse all nodes | view schema
WBsf047499 | SMap | S_parent | Sequence | R03C1 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | acatctttcttcctcgatagacatattttct | ttcatcatcatattgttgatgaggaggcccc | |
Mapping_target | R03C1 | |||
DNA_text | GATGATGATGAAGCCGTAGAT | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | ASE motif #1, a predicted Transcription-factor-binding site | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00032877 | ||
Associations | Associated_with_gene | WBGene00000584 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000130 | |||
Bound_by_product_of | WBGene00000483 | |||
Remark | Both ASE motifs contribute to cog-1 expression, albeit to notably different extents | |||
Method | TF_binding_site |