WormBase Tree Display for Feature: WBsf047499
expand all nodes | collapse all nodes | view schema
| WBsf047499 | SMap | S_parent | Sequence | R03C1 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | acatctttcttcctcgatagacatattttct | ttcatcatcatattgttgatgaggaggcccc | |
| Mapping_target | R03C1 | |||
| DNA_text | GATGATGATGAAGCCGTAGAT | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | ASE motif #1, a predicted Transcription-factor-binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00032877 | ||
| Associations | Associated_with_gene | WBGene00000584 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000130 | |||
| Bound_by_product_of | WBGene00000483 | |||
| Remark | Both ASE motifs contribute to cog-1 expression, albeit to notably different extents | |||
| Method | TF_binding_site |
