WormBase Tree Display for Feature: WBsf047498
expand all nodes | collapse all nodes | view schema
WBsf047498 | SMap | S_parent | Sequence | Y80D3A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | caccttttcccggtcatgtctcccgccaaac | gcctccccgcctacctaggcagcaatgctcc | |
Mapping_target | Y80D3A | |||
DNA_text | AAAATCGCACCTTCTC | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Last of 4 transcription factor binding sites/provisional recognition sequences | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00034727 | ||
Associations | Associated_with_gene | WBGene00013583 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000129 | |||
Bound_by_product_of | WBGene00006554 | |||
Remark | ceh-51 is a direct target of TBX-35 and at least one other factor. | |||
Method | TF_binding_site |