WormBase Tree Display for Feature: WBsf047496
expand all nodes | collapse all nodes | view schema
| WBsf047496 | SMap | S_parent | Sequence | Y80D3A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | agaacagccggaaaatctcacccaattccca | ggtgtcaccttttcccggtcatgtctcccg | |
| Mapping_target | Y80D3A | |||
| DNA_text | GGTATCTCACCTCTCC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Second of 4 transcription factor binding sites/provisional recognition sequences. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00034727 | ||
| Associations | Associated_with_gene | WBGene00013583 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000129 | |||
| Bound_by_product_of | WBGene00006554 | |||
| Remark | ceh-51 is a direct target of TBX-35 and at least one other factor. | |||
| Method | TF_binding_site |
