WormBase Tree Display for Feature: WBsf019551
expand all nodes | collapse all nodes | view schema
WBsf019551 | SMap | S_parent | Sequence | Y58A7A |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ACAAAGAAAAATTACATTTTCAGCTTCCAG | CTCTCGTTTAAACTCAAAATATCGTCGTCA | |
Mapping_target | Y58A7A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_sequence (5) | |||
Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 1 | ||
RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 1 | |||
RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 | 1 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 | 1 | |||
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 | 1 | |||
Associations | Associated_with_CDS | Y58A7A.3 | ||
Associated_with_transcript | Y58A7A.3.2 | |||
Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 1 reads | ||||
Method | SL1 |