WormBase Tree Display for Expr_pattern: Expr7198
expand all nodes | collapse all nodes | view schema
Expr7198 | Expression_of | Gene | WBGene00022673 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00022673 | ||||
Homol | Homol_homol | ZK177:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005733 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005812 | |||||
Type | Reporter_gene | [ZK177.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTATCACAGAATGTTCGGCACT] 3' and primer B 5' [GCTTTGCCAGTTGATATTGC] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; hypodermis; excretory cell; unidentified cells in head; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in head and tail may be neural. | ||||
Strain: BC10135 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002098 |