WormBase Tree Display for Expr_pattern: Expr7174
expand all nodes | collapse all nodes | view schema
| Expr7174 | Expression_of | Gene | WBGene00000376 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00000376 | ||
| Homol | Homol_homol | ZC518:Expr | |
| Expression_data | Life_stage | WBls:0000023 | |
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005733 | |||
| WBbt:0005753 | |||
| Type | Reporter_gene | [ccr-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTCAGTCAACATACGGTCG] 3' and primer B 5' [ACCATTTAAAATACCGGTCATCC] 3'. | |
| Pattern | Larval Expression: pharynx; hypodermis; seam cells; | ||
| Picture | WBPicture0000007100 | ||
| WBPicture0000007101 | |||
| Remark | Also expressed in (comments from author) : Analysis notes were lost. Have extroplated from the images.Adult and Embryo incomplete. To be updated. | ||
| Strain: BC14674 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003657 |
