WormBase Tree Display for Expr_pattern: Expr6918
expand all nodes | collapse all nodes | view schema
| Expr6918 | Expression_of | Gene | WBGene00044517 | Inferred_automatically |
|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00044517 | |||
| Homol | Homol_homol | Y32G9A:Expr | ||
| Expression_data | Life_stage | WBls:0000041 | ||
| WBls:0000023 | ||||
| Anatomy_term | WBbt:0005772 | |||
| Type | Reporter_gene | [Y32G9A.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGGGAGCCCTACTCCAGATA] 3' and primer B 5' [TCATACACATGCCGATCACTATAA] 3'. | ||
| Pattern | Adult Expression: intestine; | |||
| Larval Expression: intestine; | ||||
| Remark | Also expressed in (comments from author) : No comment | |||
| Strain: BC11562 | ||||
| Reference | WBPaper00006525 | |||
| Transgene | WBTransgene00002620 | |||
| Historical_gene | WBGene00021307 | Note: This object originally referred to WBGene00021307. WBGene00021307 is now considered dead and has been merged into WBGene00044517. WBGene00044517 has replaced WBGene00021307 accordingly. |
