WormBase Tree Display for Expr_pattern: Expr6891
expand all nodes | collapse all nodes | view schema
| Expr6891 | Expression_of | Gene | WBGene00013784 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00013784 | ||||
| Homol | Homol_homol | Y116A8C:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0005739 | Partial | |||
| Remark | unidentified cells | ||||
| WBbt:0005751 | |||||
| Type | Reporter_gene | [Y116A8C.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGACAGGCTACATGCCTA] 3' and primer B 5' [ATCCCGGAAATTTTGATAGTGTTA] 3'. | |||
| Pattern | Adult Expression: coelomocytes; unidentified cells in head; | ||||
| Larval Expression: coelomocytes; | |||||
| Picture | WBPicture0000007057 | ||||
| WBPicture0000007058 | |||||
| Remark | Also expressed in (comments from author) : usually see 2 of the 3 coelomocyte pairs, sometimes only one pair, and sometimes none. | ||||
| Strain: BC14121 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00003410 |
