WormBase Tree Display for Expr_pattern: Expr6779
expand all nodes | collapse all nodes | view schema
Expr6779 | Expression_of | Gene | WBGene00012037 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012037 | ||
Homol | Homol_homol | T26E3:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T26E3.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATGCACCATGTTTGTTT] 3' and primer B 5' [GAGATTTCTCGGCTTTCACG] 3'. | |
Pattern | Adult Expression: unidentified cells; | ||
Larval Expression: Reproductive System; developing vulva; body wall muscle; unidentified cells; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12944 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003052 |