WormBase Tree Display for Expr_pattern: Expr6586
expand all nodes | collapse all nodes | view schema
Expr6586 | Expression_of | Gene | WBGene00020201 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020201 | ||
Homol | Homol_homol | T04A6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term | WBbt:0005319 | ||
WBbt:0005747 | |||
Type | Reporter_gene | [T04A6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTAGGGGCGGAATCAA] 3' and primer B 5' [TATTGAGAATGGGGATTGCAG] 3'. | |
Pattern | Adult Expression: Reproductive System; spermatheca; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC12557 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002967 |