WormBase Tree Display for Expr_pattern: Expr6586
expand all nodes | collapse all nodes | view schema
| Expr6586 | Expression_of | Gene | WBGene00020201 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00020201 | ||
| Homol | Homol_homol | T04A6:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| Anatomy_term | WBbt:0005319 | ||
| WBbt:0005747 | |||
| Type | Reporter_gene | [T04A6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTAGGGGCGGAATCAA] 3' and primer B 5' [TATTGAGAATGGGGATTGCAG] 3'. | |
| Pattern | Adult Expression: Reproductive System; spermatheca; | ||
| Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
| Strain: BC12557 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002967 |
