WormBase Tree Display for Expr_pattern: Expr6567
expand all nodes | collapse all nodes | view schema
Expr6567 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | T01G1:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0005739 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005813 | |||||
Type | Reporter_gene | [T01G1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTATCTCCCCCATTTCATTCTT] 3' and primer B 5' [GTTCGACGTGATTTCGGG] 3'. | |||
Pattern | Adult Expression: body wall muscle; unidentified cells in head; | ||||
Larval Expression: body wall muscle; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in head, maybe neural.Embryo incomplete. To be updated. | ||||
Strain: BC11871 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002729 |