Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6465

expand all nodes | collapse all nodes | view schema

Name Class

Expr6465Expression_of (2)
HomolHomol_homolR05G6:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (15)
TypeReporter_gene[R05G6.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCCCTTTCTTTCGCATAG] 3' and primer B 5' [TGGTGGGGCGATTTTCTA] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons;
Picture (5)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14325
ReferenceWBPaper00006525
TransgeneWBTransgene00003503