WormBase Tree Display for Expr_pattern: Expr5468
expand all nodes | collapse all nodes | view schema
| Expr5468 | Expression_of | Gene | WBGene00003528 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00003528 | ||
| Homol | Homol_homol | C37H5:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005733 | ||
| Type | Reporter_gene | [nas-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTCAAATGTGGAATAAACCTGT] 3' and primer B 5' [TGAACAGAATGATGAATTGCG] 3'. | |
| Pattern | Adult Expression: hypodermis; | ||
| Larval Expression: hypodermis; | |||
| Picture | WBPicture0000009317 | ||
| Remark | Also expressed in (comments from author) : embryos have highest intensity GFPMosaic population. | ||
| Strain: BC13411 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003158 |
