WormBase Tree Display for Expr_pattern: Expr5436
expand all nodes | collapse all nodes | view schema
Expr5436 | Expression_of | Gene | WBGene00016450 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016450 | ||||
Homol | Homol_homol | C35D10:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0004292 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
Type | Reporter_gene | [C35D10.14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTGTGGTAAGGGGCATGT] 3' and primer B 5' [TCTCTGATCATGAAAAGAATGAAT] 3'. | |||
Pattern | Adult Expression: intestine; rectal gland cells; anal depressor muscle; unidentified cells in head; | ||||
Larval Expression: intestine; rectal gland cells; anal depressor muscle; unidentified cells in head; | |||||
Picture | WBPicture0000004110 | ||||
Remark | Also expressed in (comments from author) : unidentified cells in head, possibly arcade cells and other. | ||||
Strain: BC12954 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004507 |