Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5376

expand all nodes | collapse all nodes | view schema

Name Class

Expr5376Expression_ofGeneWBGene00002827
Reflects_endogenous_expression_ofWBGene00002827
HomolHomol_homolC29E6:Expr
Expression_data (2)
TypeReporter_gene[let-653::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTAGGTGGAGCGAAGCAA] 3' and primer B 5' [TTAGTGGATGTCGGATTTACTGAA] 3'.
PatternAdult Expression: intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells;
Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; head neurons;
Picture (2)
RemarkAlso expressed in (comments from author) : The listed expression pattern was from June 2004. When viewed again, May 2005, there was only hypodermis in adults.
Strain: BC10642
ReferenceWBPaper00006525
TransgeneWBTransgene00002350