WormBase Tree Display for Expr_pattern: Expr2459
expand all nodes | collapse all nodes | view schema
Expr2459 | Expression_of (2) | ||
---|---|---|---|
Expression_data | Life_stage | WBls:0000003 | |
WBls:0000041 | |||
Anatomy_term (2) | |||
GO_term | GO:0005813 | ||
Subcellular_localization | In newly fertilized embryos, SAS-4 is localized to a discrete spot near the sperm-derived pronucleus. At a slightly later stage, gamma-tubulin is recruited to the sperm centrioles forming a focus that colocalizes with SAS-4. As the embryo proceeds into mitosis, the amount of gamma-tubulin at centrosomes dramatically increases. In contrast, the SAS-4 staining remains unchanged as a small dot in the center of the centrosome. | ||
Type | Antibody | Immunofluorescence of whole worms and fixed embryos. Affinity-purified polyclonal rabbit antibody against SAS-4 recombinant protein. 6xHis tagged full-length SAS-4 was prepared by amplifying the cDNA, yk425b11, using the following primers: CGCGCGGGATCCGCTTCCGATGAAAATATCGGTG and CGCGCGCTCGAGTCATTTTTTCCACTGGAACAAAGTT, digesting the product with BamHI/XhoI and cloning into pRSET-A (Invitrogen). Antibodies to the fusion protein were generated in rabbits and affinity purified. | |
Pattern | In worms, SAS-4 colocalized with gamma-tubulin to centrosomes both in sperm and in the syncytial part of the gonad. SAS-4 staining in the gonad disappeared as the meiotic nuclei cellularized to form oocytes, presumably marking the point at which the centrioles are lost during oogenesis. | ||
Reference | WBPaper00005739 | ||
Antibody_info | WBAntibody00000606 |