WormBase Tree Display for Expr_pattern: Expr10207
expand all nodes | collapse all nodes | view schema
Expr10207 | Expression_of | Gene | WBGene00018607 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018607 | |||
Expression_data | Life_stage | WBls:0000003 | ||
WBls:0000041 | ||||
WBls:0000023 | ||||
Anatomy_term | WBbt:0008378 | Certain | ||
Type | RT_PCR | Primers: CCTTCAAGACTTCTGACCGAATGCCCG (F) GTTTGTGGCCAATATGGGCTGCTGACC (R) | ||
Pattern | Using semi-quantitative RT-PCR, we show that F48E3.8 is somatically expressed. F48E3.8 was first detected at 24 h following hatching, when grown at 25 C.F48E3.8 continued to be expressed at 48 h and 72 h. Adults first appeared at the 72 h time point and F48E3.8 showed clear expression despite the significant attenuation of the germline.F48E3.8 expression persisted through to 120 h. F48E3.8 was expressed in the absence of a germline and it appeared to persist into adulthood. All three predicted transcripts of F48E3.8 include sequence coding for the PDA domain. The demonstration of F48E3.8 expression in larval and adult stages contrasts with in situ data that showed expression was restricted to embryos (NEXTDB, http://nematode.lab.nig.ac.jp/). This may reflect increased sensitivity afforded by RT-PCR or differences in expression of alternative transcripts of F48E3.8. | |||
Picture | WBPicture0000012790 | |||
Reference | WBPaper00041310 |