WormBase Tree Display for Construct: WBCnstr00020503
expand all nodes | collapse all nodes | view schema
| WBCnstr00020503 | Summary | [lin-4::gfp] | |
|---|---|---|---|
| Driven_by_gene | WBGene00002993 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [lin-4::gfp] transcriptional fusion. Lin4GFPAS (lin-4::gfp) was made by amplifying 507 bp of genomic sequence (base pairs -513 to -7) upstream of the mature lin-4 sequence from N2 genomic DNA and adding a SmaI site and an AgeI site to the 5' and 3' ends, respectively, using the polymerase chain reaction (PCR) with primers LIN4LB3 (CAACAACCCGGGGTCGACGAGACGCCGAGTCTCCC) and LIN4LB1 (CAACAAACCGGTAGGCCGGAAGCATAAACTCATAAACC). This product was digested with SmaI and AgeI and then cloned into the pPD95.70 vector (gift from A. Fire), which was also digested with SmaI and AgeI. Digestion of pPD95.70 with SmaI and AgeI removed the nuclear localization signal (NLS) from this vector. | ||
| Clone | pPD95.70 | ||
| Used_for | Transgene_construct | WBTransgene00031791 | |
| Reference | WBPaper00026854 |
