WormBase Tree Display for Construct: WBCnstr00020471
expand all nodes | collapse all nodes | view schema
WBCnstr00020471 | Summary | [ser-2prom3::RSP-3::myr-mCherry] | |
---|---|---|---|
Driven_by_gene | WBGene00004777 | ||
Gene | WBGene00004700 | ||
Fusion_reporter | mCherry | ||
Type_of_construct | Translational_fusion | ||
Construction_summary | [ser-2prom3::RSP-3::myr-mCherry]. The cDNA was PCR-amplified without stop codons and was cloned in pDONR221 using Gateway BP Clonase II (Invitrogen). The ser-2 promoter 3 fragment (Tsalik and Hobert 2003) was PCR-amplified and cloned into pDONR P4-P1r and the GFP coding sequence with the let-858 3' UTR from pPD117.01 was PCRamplified and cloned into pDONR P2r-P3 using Gateway BP Clonase II (Invitrogen). The cDNAs, ser-2 promoter 3, and GFP were all cloned into pDEST R4-R3 using Gateway LR Clonase II Plus (Invitrogen). Primers: attB1 - atgccacgcggcggctcagagg attB2 - ttgtggagatggtgagcgagatgg. | ||
Clone | pDEST R4-R3 | ||
Used_for | Transgene_construct | WBTransgene00031781 | |
Reference | WBPaper00046432 |