WormBase Tree Display for Construct: WBCnstr00018376
expand all nodes | collapse all nodes | view schema
WBCnstr00018376 | Public_name | pGAC4 | |
---|---|---|---|
Summary | [GST::abi-1-SH3] | ||
Gene | WBGene00015146 | ||
Construction_summary | pAGC4 contains GST::abi-1-SH3 and was created by using the following primers to amplify DNA encoding the SH3 domain of ABI-1: fwd:gccacaagcgatccagtctctttgatacgagtgct and rev: gcca- caaggaattctcatactggaactacgtagtt. The PCR product was cut with BamHI and EcoRI and cloned into the same sites of pGEX-2T. | ||
Used_for | Transgene_construct | WBTransgene00019023 | |
Reference | WBPaper00042403 |