WormBase Tree Display for Construct: WBCnstr00014344
expand all nodes | collapse all nodes | view schema
| WBCnstr00014344 | Public_name | fUL#HC121 | |
|---|---|---|---|
| Other_name | Expr9824_Ex | ||
| Summary | [F26H11.2::GFP; pRF4] | ||
| Driven_by_gene | WBGene00009180 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC121. The reporter gene fusion assayed was made by recombineering fUL#HC88 (WRM0610dH04/WRM0629dF11). Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: cgaacattcttaagcttatcgattttcgaaaagtttcgaaattttttcag, tttccggattcagacggatgctttcgctttgaacggccacgtggtggagc. gfp was inserted immediately after the start codon of nurf-1i The expression pattern is expected to correspond to transcripts nurf-1a, nurf-1b, nurf-1c and nurf-1i, This large gene was reconstructed by joining two fosmids together by recombineering before inserting the gfp. (An independent transgenic strain was assayed for this reporter gene fusion and gave the same expression pattern but had a very low transgene transmission rate and was not retained.) pRF4 cotransformant: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031269 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
