WormBase Tree Display for Construct: WBCnstr00011690
expand all nodes | collapse all nodes | view schema
| WBCnstr00011690 | Other_name | Expr3839_Ex | |
|---|---|---|---|
| Summary | [smk-1::smk-1-gfp] | ||
| Driven_by_gene | WBGene00018285 | ||
| Gene | WBGene00018285 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [smk-1::smk-1-gfp] translational fusion. To construct the plasmid expressing SMK-1-GFP driven by smk-1 endogenous promoter (pRP4), sequences 3 kb upstream of the smk-1 coding region were amplified from genomic DNA by PCR and inserted upstream of GFP sequences in the worm expression vector pPD95.77. Full-length smk-1 cDNA was amplified as N$(B!l(B- and C$(B!l(B-fragments from a first-strand worm cDNA by PCR. The N$(B!l(B fragment was digested with NotI and BglI, and the C$(B!l(B fragment was digested with BglII and KpnI, respectively. Both fragments were ligated and inserted downstream of the promoter sequences in frame with the GFP sequence at the C terminus. Primers for the N$(B!l(B fragment: forward, GTTTTGCGGCCGCATGTCGGACACAAAAGAGGTATC; reverse, AGTGCCAGATCTCGCCGACG. Primers for the C$(B!l(B fragment: forward, TGCTGCCCTCCCGGCATCTC; reverse, GTTTTGGTACCCTGGCCTGCGAAACTGTGGC. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00028906 | |
| Reference | WBPaper00027157 |
