WormBase Tree Display for Construct: WBCnstr00008391
expand all nodes | collapse all nodes | view schema
WBCnstr00008391 | Public_name | pEB73 | |
---|---|---|---|
Summary | [Pmca-3::GFP] | ||
Driven_by_gene | WBGene00003153 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = pEB73. This construct consists of a 2.5-kb region upstream of mca-3 ATG, amplified from genomic wild-type DNA with oligos oEB232 [AATTCTGCAGCACAATGGCTACAGTAGCC] and oEB237 [TTCTACCGGTACCCGAAGCTCCTCCAGTGATG]. These primers append PstI and AgeI restriction sites, respectively. The promoter fragment was then inserted into a PstI and AgeI digested Fire lab vector pPD95.75 to produce a transcriptional GFP fusion. | ||
Used_for | Transgene_construct | WBTransgene00008688 | |
Reference | WBPaper00029172 |