WormBase Tree Display for Construct: WBCnstr00007021
expand all nodes | collapse all nodes | view schema
| WBCnstr00007021 | Public_name | pPD117.01-ppcs1::GFP | |
|---|---|---|---|
| Other_name | Expr9005_Ex | ||
| Summary | [Ppcs-1::GFP] | ||
| Driven_by_gene | WBGene00003960 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | The transcriptional reporter ppcs-1::GFP was constructed by placing the PCR-amplified 1589 bp genomic DNA fragment upstream of 59 of the start of pcs-1 into SphI/KpnI sites of the pPD117.01 vector [38]. The primer pairs for PCR-amplification of the pcs-1 promoter were: 59-CTCCAGAAGCATGCC- TATTGTCCTGGGTGCGATATTCT and 39- CCGACATGGTACCTTTTGAAGTGTCTGCAATTAT. The resulting pP- D117.01-ppcs1::GFP construct (80 ng/ml) was co-injected with a plasmid, carrying a functional unc-119 (100 ng/ml) into the gonadal syncytium of unc-119 (ed3) animals [39,40] (Schwartz et al., 2010). | ||
| Clone | pPD117.01 | ||
| Used_for | Transgene_construct | WBTransgene00007196 | |
| Reference | WBPaper00036020 |
