WormBase Tree Display for Construct: WBCnstr00000145
expand all nodes | collapse all nodes | view schema
| WBCnstr00000145 | Public_name | pV2B3 | |
|---|---|---|---|
| Other_name | V2B3 | ||
| Summary | [vit-2p::VIT-2::GFP] | ||
| Driven_by_gene | WBGene00006926 | ||
| Gene | WBGene00006926 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. | ||
| Used_for | Transgene_construct | WBTransgene00000145 | |
| WBTransgene00000146 | |||
| WBTransgene00000147 | |||
| WBTransgene00000148 | |||
| Interactor (16) | |||
| Reference (61) |
