WormBase Tree Display for Sequence: Y75B12A

Y75B12A DNA: Y75B12A 3275
  SMap: S_child: Gene_child: WBGene00014949 1275 2335
      CDS_child (15)
      Transcript: Y75B12A.3:wp239 267 560
      Pseudogene: Y75B12A.1 1275 2335
      PCR_product: mv_Y75B12A.1 1276 2333
        p_Y75B12A.2_93 2334 3014
        sjj_Y75B12A.1 1241 2323
      Allele (34)
      Oligo_set: Aff_Y75B12A.2 3132 3783
      Feature_object: WBsf1020979 1175 1325
        WBsf102241 1422 1422
        WBsf967467 2002 2003
        WBsf647578 2983 2988
      Feature_data: Y75B12A:Polysome 1 3275
        Y75B12A:TranscriptionallyActiveRegion 1 3275
        Y75B12A:TRF 1 3275
        Y75B12A:Dust 1 3275
        Y75B12A:inverted 1 3275
      Homol_data: Y75B12A:RNAi 1 3275
        Y75B12A:SAGE 1 3275
        Y75B12A:wublastx_brenneri 1 3275
        Y75B12A:wublastx_briggsae 1 3275
        Y75B12A:wublastx_japonica 1 3275
        Y75B12A:wublastx_remanei 1 3275
        Y75B12A:wublastx_worm 1 3275
        Y75B12A:RepeatMasker 1 3275
  Structure: From: Source: CHROMOSOME_V
    Overlap_right: T01G5 3172
    Overlap_left: C01G10
    Clone_left_end: T01G5 3172
      Y75B12A 1
    Clone_right_end: C01G10 106
      Y75B12A 3275
  DB_info: Database: EMBL NDB_AC AL032662
        NDB_SV AL032662.1
    Secondary_accession: AL022301
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: White S
    From_laboratory: HX
    Date_directory: 980708
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: Y75B12A
  Properties: Genomic_canonical
    Checksum: MD5: 6d094f76d342172e1beb0acc7459c21c
    Status: Finished: 08 Jul 1998 00:00:00
      Submitted: 29 Oct 1998 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-V Ends: Left: 8595
        Right: 8603
  Interpolated_map_position: V 7.39995
  Assembly_tags: comment 167 173 ?Oligo in repeat thats why didn't work
      541 546 ?END of repeat can make oligo ->
      966 964 ?End of repeat oligo worked b/c outside repeat
    oligo 148 166 serial#=Y75B12-01 template=us80h10 sequence=GTAGAGTGTCACAAATAAC flags=
      395 416 serial#=Y75B12-05 template=us80h10 sequence=GATTGGAGCTTCATTATTTTTG flags=
      1005 988 serial#=Y75B12-04 template=uv67b7 sequence=GTTATTCACCAGTTGCTC flags=
    cosmid vector 756 697
      2074 2095
      1966 1953
    repeat 119 1 Repeats with contig us80h11.p2c1, offset 200
      280 121 Repeats with contig us80h11.p2c1, offset 38
      378 350 Repeats with contig C01G10.00001, offset 39025
      477 449 Repeats with contig C01G10.00001, offset 38926
      546 510 Repeats with contig uu30e5.p1, offset 72258
      706 510 Repeats with contig uv73h12.p1, offset 8573
        547 Repeats with contig C01G10.00001, offset 38697
      988 547 Repeats with contig us80h11.p2c1, offset 38
          Repeats with contig uv65d6.q1t, offset 1
          Repeats with contig us81b12.q1tU, offset 93904
      848 709 Repeats with contig C01G10.00001, offset 38556
          Repeats with contig uv73h12.p1, offset 8431
      950 850 Repeats with contig uv73h12.p1, offset 8329
          Repeats with contig C01G10.00001, offset 38454
      2434 2380 Repeats with contig C01G10.00001, offset 38387
      2509 2436 Repeats with contig C01G10.00001, offset 38312
      2638 2528 Repeats with contig C01G10.00001, offset 38183
    Finished Left 1 4 Y75B12A
    Clone right end 102 105 C01G10
    stop 968 971
    Clone left end 3172 3175 T01G5
    Finished Right 3275 3272 Y75B12A
  Method: Genomic_canonical