WormBase Tree Display for Sequence: Y57A10A
expand all nodes | collapse all nodes | view schema
| Y57A10A | DNA | Y57A10A | 165339 | ||
|---|---|---|---|---|---|
| SMap | S_child (13) | ||||
| Structure | From | Source | CHROMOSOME_II | ||
| Overlap_right | C50E10 | 164716 | |||
| Overlap_left | Y43F11A | ||||
| Clone_left_end | Y57A10 | 1 | |||
| C50E10 | 165216 | ||||
| Y57A10A | 1 | ||||
| Clone_right_end | Y43F11 | 15959 | |||
| Y57A10A | 165339 | ||||
| DB_info | Database | EMBL | NDB_AC | AL117195 | |
| NDB_SV | AL117195.2 | ||||
| Secondary_accession | AL020986 | ||||
| DB_remark | [991221 ag3] Y57A10A.12 has been fused with Y57A10A.13 based on yk115c11 | ||||
| [121025] Sequence correction: SNP 0 bases @ 34530 | |||||
| [121025] Sequence correction: SNP 0 bases @ 38208 | |||||
| [121025] Sequence correction: SNP 0 bases @ 42524 | |||||
| [121025] Sequence correction: SNP 0 bases @ 56888 | |||||
| [121025] Sequence correction WBsf268047 : Insertion G1 bases from @ 93802 | |||||
| [121025] Sequence correction WBsf268587 : Deletion G-1 bases @ 136615 | |||||
| Keyword | HTG | ||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
| Origin | From_author | Smye R | |||
| From_laboratory | HX | ||||
| Date_directory | 990520 | ||||
| Species | Caenorhabditis elegans | ||||
| Strain | WBStrain00000001 | ||||
| Visible | Clone | Y57A10A | |||
| Remark | Transposon Y57A10A.34 converted into an S_Child [020208 kj] | ||||
| Properties | Genomic_canonical | ||||
| Checksum | MD5 | a058bec9d616c8154067dcf4756e6849 | |||
| Status | Finished | 20 May 1999 00:00:00 | |||
| Submitted | 20 May 1999 00:00:00 | ||||
| Annotated | 05 Nov 1999 00:00:00 | ||||
| Map | Sequence-II | Ends | Left | 7262 | |
| Right | 7279 | ||||
| Interpolated_map_position | II | 7.04452 | |||
| Assembly_tags | Clone left end | 1 | 6 | Y57A10 | |
| 165219 | 165216 | C50E10 | |||
| Finished Left | 1 | 6 | Y57A10A | ||
| Clone right end | 15954 | 15959 | Y43F11 | ||
| annotation | 20889 | 21064 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from reads from a short insertlibrary derived from a single pUC clone. | ||
| 69920 | 70026 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from reads from a short insertlibrary derived from a single pUC clone. | |||
| 79042 | 79066 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -Sequence from reads from a short insertlibrary derived from a single pUC clone. | |||
| 81861 | 81867 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here - Sequence from single terminator read forming part of loop of an inverted repeat. Assembly is confirmed by PCR ofYAC DNA. | |||
| 130342 | 130369 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Unidirectional primer reads only. | |||
| 132673 | 132680 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [x] Tandem repeat [ ] Single clone region [ ] Forced join [ ] Other Add a comment here - One clone has 33 GA's and two have 37 GA's | |||
| 145698 | 145706 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - Arm of inverted repeat. Bridge confirms assembly. | |||
| 158308 | 158392 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - Uni-directional primer reads only. | |||
| 34937 | 35909 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[x] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here - Tandem repeat of unknown size. Each element 30 bases long, typical sequence:TACCATAACCAAACTACAGTAGTACTGTAG | |||
| 67198 | 67266 | First select a Feature - [ ] Unsure [x] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [x] Single clone region [ ] Forced join [ ] Other Add a comment here - pUC clone bridges, so confirms assembly. | |||
| 88749 | 88832 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here - Sequence from a single terminator read.Region is not bridged by other pUC clones. | |||
| 145728 | 145728 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - In inverted repeat region. | |||
| 145730 | 145734 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - In inverted repeat region. | |||
| 145752 | 145752 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [x] Other Add a comment here - In inverted repeat region. | |||
| Finished Right | 165336 | 165339 | Y57A10A | ||
| Method | Genomic_canonical |
