WormBase Tree Display for Sequence: Y49A10A

Y49A10A DNA: Y49A10A 24050
  SMap: S_child: Gene_child: WBGene00044949 20231 18310
        WBGene00013028 5950 8117
      CDS_child (65)
      Transcript: Y49A10A.1.1 5950 8117
        Y49A10A.2.1 20231 18312
        Y49A10A.2.2 19926 18310
      PCR_product: cenix:110-h6 6558 7447
        mv_F46F6.1b 21171 22404
        mv_Y49A10A.1 6062 8040
        sjj2_F46F6.1a.1 22196 23383
        sjj2_Y49A10A.2 18758 19897
        sjj_Y49A10A.1 6105 7289
        smd_Y49A10A.1 6479 7643
      Allele (280)
      Oligo_set: Aff_F46F6.1A 22379 21169
        Aff_Y49A10A.1 7214 8042
      Feature_object (87)
      Feature_data: Y49A10A:Polysome 1 24050
        Y49A10A:TranscriptionallyActiveRegion 1 24050
        Y49A10A:ChIPSeqTF 1 24050
        Y49A10A:TRF 1 24050
        Y49A10A:Dust 1 24050
        Y49A10A:inverted 1 24050
      Homol_data (16)
  Structure: From: Source: CHROMOSOME_X
    Overlap_right: F46F6 23940
    Overlap_left: R07E3
    Clone_left_end: F46F6 23940
      Y49A10A 1
    Clone_right_end: R07E3 104
      Y49A10A 24050
  DB_info: Database: EMBL NDB_AC AL032624
        NDB_SV AL032624.1
    Secondary_accession: Z93240
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: Lennard N
    From_laboratory: HX
    Date_directory: 980727
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: Y49A10A
  Properties: Genomic_canonical
    Checksum: MD5: e53bf22b71d0cabbcdb4a26a85c3fa03
    Status: Finished: 27 Jul 1998 00:00:00
      Submitted: 29 Oct 1998 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-X Ends: Left: 5555
        Right: 5594
  Interpolated_map_position: X 1.97869
  Assembly_tags: Clone right end 104 99 R07E3
    Clone left end 23940 23943 F46F6
    Finished Left 1 4 Y49A10A
    annotation 9084 16730 First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[X] Single clone region[X] Forced join[ ] OtherAdd a comment here -Tandem repeat, exact length unknown.Approximately 7.9Kb of a TTTGGTGAAGCCAGGAGTAAAAAA motif assembled in with several base differences,2 forced joins and 2 single clone regions.The other motifs areTATGGTGAAGCCAGAGAGTAAAATATTGGGTGAAGCCAGAGAGTAAAATATTGGGTGAAGCCTAAGAGTAAAAAATATGGTGAAGCCAGAGAGTAAAAAATATGGTGAAGCCAGAGAGTACAATATTTGGTGAAGCCATAGAGTAAAATATATGGTGAAGCCAGAGAGTCAAATATACGGTGAAGCCAGAGAGTAAAATATTGAGTGAAGCCAGAGAGTCAAATA
      16746 17893 First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[X] Forced join[ ] OtherAdd a comment here -Tandem repeat, exact length unknown.Approximately 1.1Kb of TTATGGAGCGG motif assembled in with some base differences and 1 forced join.
    Finished Right 24050 24047 Y49A10A
  Method: Genomic_canonical