WormBase Tree Display for Feature: WBsf978789
expand all nodes | collapse all nodes | view schema
WBsf978789 | SMap | S_parent | Sequence | R13F6 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | tatgcacacaactatcaaattaagattcta | cggattactgcatatgcatggtccagctgt | |
Mapping_target | R13F6 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible (2) | ||||
Defined_by | Defined_by_paper | WBPaper00042525 | ||
Associations | Associated_with_gene | WBGene00004857 | ||
Associated_with_Interaction (15) | ||||
Remark | [150922 gw3] This is a region upstream of R13F6.9 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
Method | promoter |