WormBase Tree Display for Feature: WBsf977697
expand all nodes | collapse all nodes | view schema
| WBsf977697 | SMap | S_parent | Sequence | W01G7 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | attaaccagccgtggaccgcacctccggcg | tccaaatgcggcgatcttcacaatcatgaa | |
| Mapping_target | W01G7 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Highly Occupied Target (HOT) region bound by many transcription factors. | ||
| Defined_by | Defined_by_paper | WBPaper00045011 | ||
| Defined_by_analysis | modENCODE_HOT_WBPaper00045011 | |||
| Score | 67 | |||
| Associations | Associated_with_transcription_factor | WBTranscriptionFactor001157 | ||
| Bound_by_product_of (66) | ||||
| Remark | [141104 gw3] This is reanalysis of the HOT regions in the modENCODE data using updated data. The previous dataset has an Analysis of 'modENCODE_HOT'. | Paper_evidence | WBPaper00045011 | |
| Method | binding_site_region |
