WormBase Tree Display for Feature: WBsf975995
expand all nodes | collapse all nodes | view schema
| WBsf975995 | SMap | S_parent | Sequence | F29F11 |
|---|---|---|---|---|
| Name | Public_name | de209 | ||
| Sequence_details | Flanking_sequences | aagaagttgagcaaaaaagattacggtaag | ttggatccaaaagccaaaattgttgatgag | |
| Mapping_target | F29F11 | |||
| DNA_text | tggacaaacagataacgcggccgtattt | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the 'de209' enhancer region for ceh-22 in the DE3 region. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00006411 | ||
| Associations (4) | ||||
| Method | enhancer |
